• CRISPR Crash Course - Week 2 Quiz

    Design your own sgRNA!

  • Using Harvard’s Chop Chop software and our guidelines, choose a target site for use with spCas9 for knockout of the human A1BG gene. Enter a good target site below in the 5'->3' direction, including the PAM sequence).

    Keep in mind the following guidelines:

    • 20nt immediately upstream of the PAM sequence 5’-NGG-3’
    • Targets an early exon in the gene
    • Highest predicted cleavage efficiency with fewest potential off-target matches
    • If possible, it should start with a ‘G’ to initiate transcription by a U6 or T7 promoter

  • Accepted answers were (5' to 3', including the PAM sequence): 
    GCTGCAGCTACCGGACCGATGGG
    CTGCAGCTACCGGACCGATGGGG
    AGCTACCGGACCGATGGGGAAGG
    CTTACGGGGGCTGTCTCCGCAGG

    Good job! This target site is a good choice because it occurs early in the gene, has no identified off-target matches, and a high predicted efficiency. As well, this sequence begins with a ‘G’, which can be used to initiate transcription by a U6 or T7 promoter if the sgRNA will be expressed from a vector.

    Remember, though, that sgRNA design is not perfect, and therefore sgRNAs should always be verified in vitro before use in vivo.

  • Accepted answers were (5' to 3', including the PAM sequence): 
    GCTGCAGCTACCGGACCGATGGG
    CTGCAGCTACCGGACCGATGGGG
    AGCTACCGGACCGATGGGGAAGG
    CTTACGGGGGCTGTCTCCGCAGG

    Good job! This target site is a good choice because it occurs early in the gene, has no identified off-target matches, and a high predicted efficiency. It doesn’t start with a ‘G’ for initiating transcription, but this can be done by adding one or two ‘G’s at the start of the target site when designing your sgRNA.

    Remember, though, that sgRNA design is not perfect, and therefore sgRNAs should always be verified in vitro before use in vivo.

  • Congrats! You correctly identified a good target for a CRISPR knockout with spCas9!

    You are now a sgRNA Scholar. 

  • Sorry... You did not correctly identify a good sgRNA target for spCas9 on our Week 2 Quiz.

    Try again? Or click 'Next' to see the answers.

  • Accepted answers were (5' to 3', including the PAM sequence): 
    GCTGCAGCTACCGGACCGATGGG
    CTGCAGCTACCGGACCGATGGGG
    AGCTACCGGACCGATGGGGAAGG
    CTTACGGGGGCTGTCTCCGCAGG

     

    There are many possible answers! Here are some examples of good target sites:

    These target sequences all occur in the first exons of the gene, have no identified off-target matches, and high-to-medium predicted efficiency. As well, one of the target sites starts with a ‘G’, which can be used to initiate transcription by a U6 or T7 promoter if the sgRNA will be expressed from a vector.

    Remember that sgRNA design is not perfect, and therefore sgRNAs should always be verified in vitro before use in vivo. 

  • Should be Empty: