2045307

AAV request form for Dementia Research Centre (DRC)

Please direct any enquires regarding this form to Yijun at yijun.lin@mq.edu.au.
Particulars of requesters
Full Name*

First NameLast Name
Supervisor's Name*

First NameLast Name
Email*
example@example.com
Supervisor's Email*
example@example.com
Important notice

Please read first before requesting AAVs
Quantitative real-time PCR (qPCR) or Digital Droplet PCR (ddPCR) is currently used to measure the titer of AAVs. Primer pairs specifically designed for qPCR/ddPCR are required as part of AAV production.

Before providing the details of your requests, please check whether or not, any of the following primer pairs is found in the sequence(s) of your plasmid(s) flanked by the two inverted terminal repeats (ITRs):

WPRE

WPRE_F:

GGCTGTTGGGCACTGACAAT

WPRE_R:

CCGAAGGGACGTAGCAGAAG

CBA-eGFP

CBA-eGFP_F:

CTGGTTATTGTGCTGTCTC

CBA-eGFP_R:

CTTGCTCACCATGGTGG

If not, you must answer "Neither, I will provide my own set of primers" in your request. Please refer to the links below on designing good primer pairs for qPCR. The principles of primer design for ddPCR and qPCR are the same.

Having said that, if your sequence contains any of the above primer pairs, you are welcome to design and provide your own qPCR primer pairs if you wish, especially if you'd like to target a specific sequence.

https://bitesizebio.com/10041/designing-qpcr-primers/

https://iubmb.onlinelibrary.wiley.com/doi/full/10.1002/bmb.20461
Request details
Please provide details of your request. One replicate yield is the total amount of AAVs produced by transfection of ten 150mm dishes.*
DNA Calculator

For your reference only; not required to fill in for submission
Value detector

Calculate, based on your input, the minimum amount of DNA to provide.

	No. of Replicates (10 dishes per replicate)	Providing DNA for plasmid bank?
Please specify:

You are to provide a minimum amount of DNA specified below in µg.
Plasmid map files

Requests with missing plasmid files will be void with no reminders.
Have you already provided plasmid map file(s) for ALL above plasmid(s)?*

Yes, in the plasmid bank.Yes, not in the plasmid bank but they have been provided before.No, I'll upload them now.
Please upload your plasmid map files here. The request is void if any of the plasmid files are missing and no reminders will be given.*

Browse Files

Cancelof
Questionnaire

Answer correctly in order to proceed with submission.
Do you understand that primer pairs designed for purposes other than qPCR/ddPCR (e.g. sequencing, site-directed mutagenesis), should NOT be provided for titering of AAVs?*

YesNo
Do any of the sequence(s) of the above plasmid(s) flanked by the ITRs exceed 4.7kbp in size (including ITRs)?*

YesNo
Do the size(s) exceed 4.9kbp?*

Yes - you will not be able to proceed. The AAV packaging limit is widely published.No - please explain.
Please state the size of your plasmid(s) and explain. Do note that truncation may occur and this may affect the expression of your gene of interest.*
Has a diagnostic restriction digest been performed on your plasmid preps? Please note that the very prep you hand over for AAV production must be diagnostically digested.*

YesNo
Have the preps of the above plasmids(s) been sequenced?*

YesNo
Did you perform at least five Nanodrop readings on the plasmid preps?*

YesNo
Is the standard deviation of the Nanodrop readings acceptably low? (*

YesNo
All good!

Please provide the following; either directly to Yijun or place in the "Plasmids Not Banked" box in Freezer 6 in Hub 1.53, all at the same time:
- A bare minimum of 150 μg of plasmid DNA for one replicate, add 125 μg for every additional replicate for each request listed above. A calculator is provided above for easy reference.
- An additional 100 μg of DNA for plasmid bank, if you answered "I will provide DNA for making AAVs and plasmid bank at the same time".
- The master tubes of primer pair(s) designed for qPCR, if you answered that you will provide your own set of primers.
It is your responsibility to provide all these items in good order, otherwise your request will be void until then. NO reminders will be given for missing items or DNA below minimum amount. However, you are welcome to make an enquiry or check the AAV spreadsheet for missing items.
I agree to the above.*

YesNo
Additional comments:
Should be Empty:

AAV request form for Dementia Research Centre (DRC)

Particulars of requesters

Important notice

Request details

DNA Calculator

Plasmid map files

Questionnaire